torialexis1119 torialexis1119

02-10-2020
Chemistry

contestada

A reaction of 12.640 g of copper oxide with 0.316 g hydrogen
produces 2.844 g of water and Xg of copper X = _g

Respuesta :

xcfgvhbjnkml xcfgvhbjnkml

02-10-2020

Answer:

x = 10.2g

Explanation:

CuO + H2 --> H2O + Cu

12.640 g CuO/ 79.55g =0.16 mol

0.16 mol CuO x 1 mol of Cu = 0.16 mol Cu

0.16 mol Cu x 63.546 g = 10.2g of Cu

Answer Link

Otras preguntas

Why did other groups needed to be targeted by the Nazis?

Find the length of AC

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

In the space below, write a full narrative description of an event in your memory; you may write a prose piece or a poem. A prose piece must be at least 300 wor

3-quart carton of milk costs $4.92. What is the price per cup?

please please please helpppppppppppppppppppp

1. Which of the following two relations is reflexive, irreflexive, transitive, antisym- metric, symmetric, asymmetric, total, a preorder, a partial order, an eq

Just a. please. I’ll put the points at 50

there are $320 available to fence in a rectangular garden. the fencing for the side of the garden facing the road cost $6 per foot and the fencing for the other

A mother is m years old, and she is 4 times as old as her daughter. How much older is the mother than the daughter?