104170angel 104170angel

11-12-2022
Biology

contestada

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated DNA strand) GTAGTAGTAGGAGTAGTAGTA. What type of mutation is illustrated? A insertion B Translocation C Substitution D Deletion

Respuesta :

Otras preguntas

describe the relationship between the value of a dollar and the value of a dime

A stone falls from ledge and takes 16 seconds to hit ground. The stone has an original velocity 0 m/s, How tall is the ledge?

Tia is buying paper cups and plates. Cups come in packages of 12,and plates come in packages of 10. She wants to buy the same number of cups and plates, but pla

What represents instantaneous velocity on a graph?

Two pounds of peaches at the farmers market cost $4.20.How much will 5 pounds cost?

is the decimal form of 13/3 a rational number.

Last summer, at Camp Okey-Fun-Okey, the radio of the number of boy campers to the number of girl campers was 8:7. If there were a total of 195 campers, how many

What is the value of 5 in 356,039,763

there are 12 small gift bags .Each bag ca

how do I write 0.25 as a fraction in its simplists form