krish256
krish256 krish256
  • 12-02-2020
  • Mathematics
contestada

please help me every one​

please help me every one class=

Respuesta :

lillypad0
lillypad0 lillypad0
  • 12-02-2020
What question do you need help on because I can see you did one of them
Answer Link

Otras preguntas

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
Tito loves to tell jokes and feels great after hanging out with friends or going to parties. which big five trait describes this? a.neuroticism b.openness to
Which best compares the roles of nitrogen-fixing bacteria and certain decomposers in the nitrogen cycle? Both organisms convert free nitrogen into nitrogen-cont
4 yd 2 ft = ____ ft (what should go in the space)
State the geometric sequence both recursive and explicit formulas.
If John scores 20% of his team’s points in basketball, how many points does the team score if John scores 14 points?
How was the textile industry most improved? An influx of able workers Increase of raw materials New technology New management techniques
The sum of angle one and angle four and the sum of angle three and angle for I eat equal to 180° by the definition of supplementary angles the sum of angle one
If Tim and Terry started to run in opposite directions with the speeds of 90 feet per minute and 11 feet per minute respectively, how far away from each other w
A rectangular prism has a volume of 468 cubic meters. It has a length of 12 meters and a width of 6 meters. What is the height of the prism?