Skullking Skullking

14-03-2018
Biology

contestada

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the above (Question 2) transcription.

Respuesta :

bluenote bluenote

14-03-2018

3’ tcgccctactcgcgtacaccgcgtattgac 5’ turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

Answer Link

Otras preguntas

Please help! What's wrong with the sentences?

what made Andrew carnegie hugely wealthy??

“[T]o the victor belong the spoils of the enemy.” In this quotation, Senator William Marcy was comparing politics to sports. business. war. peace.

I need help please explain

What is this when you subtract 4

A government in which powers are divided between a national government and state governments with the national government being supreme is called a.a confederat

How does the marrow in the medullary cavity compare with the marrow in the spaces of the spongy bone

The coppice method of regenerating trees is practiced by doing what to all of the trees in a stand at the same time? a.planting b.cutting c.fertilizing d.

What term is used to describe the people and events that influence a writer

I only need number 30 answered