syakatally882 syakatally882
  • 04-05-2018
  • Biology
contestada

Ores are naturally occurring materials that can be mined profitably. true or false

Respuesta :

takahiro
takahiro takahiro
  • 17-05-2018
For the answer to the question above, I think the answer is TRUE

Ores are valuable, they are raw materials and when extracted and processed they have a valuable mineral like metal or any other precious metal like platinum and silver. The minerals will only be mined if it is profitable
Answer Link
Аноним Аноним
  • 18-12-2018

the answer to your question is true

Answer Link

Otras preguntas

Help! I don't know how to graph this reflection
What is the value of x in the following equation: 2x+4x=15 ?
Item 12 POSSIBLE POINTS: 5 Given the equation y=25(1.025)x y = 25 ( 1.025 ) x , at what percentage rate is the exponential function decreasing or increasing? De
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
A shaman is a person who ________. question 11 options: acts as an intermediary between the invisible spirit world and the physical realm of humans ties
Reread lines 8-20 note the words or phrases that are in quotes.why does the author use quotation marks with these words or phrases?
Mrs. mcglashan is making paint for her class
Pls help me um I need help easy
In comparison to Mozart's Fortieth Symphony, the orchestra that played Beethoven's Fifth Symphony had A. fewer drummers. B. more primitive instrumen
PLEASE HELP ME WITH THIS Please and do NOT post random answers**