mfowler3760 mfowler3760

02-03-2018
History

contestada

Candidate who received the backing of his home state rather than that of the national party

Respuesta :

MomoLofty MomoLofty

02-03-2018

A candidate who received the backing of his/her home state rather than that of the national party is called a Favorite Son.

Answer Link

destinybills destinybills

13-04-2021

Answer:

a on edu history

Explanation:

Answer Link

Otras preguntas

Which of the following is the equation of a line with the points (8, 3)(9, 5) and a slope of 2?

how did technological advances in agricultural equipment after World War 2 affect georgia?

It costs a company $50 materials, labor, and other costs to produce a certain style of backpack. However, in the current market, consumers are only willing to p

How did the economic crises in the United States and Germany in the early 1930s affect the global economy?

Using household measuring tools use these conversions to record is a capacity of the bottle milliliters 1 cup equals 240 mL in 1 tablespoon equals 50 mL 1 teasp

punch recipe calls for lemonade soda ratio of 1:2 if there are 120 gallons of punch how many gallons of lemonade were used?

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

Given f(x)=3x−4 and g(x)=x2−3, find (g ∘ f)(x). Question 6 options: 9x2+13 3x2−13 9x2−24x+19 9x2−24x+13

Please help me I just don't understand!!!!!!!!!!!!!

25 POINTS!!! PLEASE ANSWER- Identify and explain a significant decision made by George Washington as president that had immediate consequences for the United St