alexisgarza200p0xdo1 alexisgarza200p0xdo1

14-12-2017
Mathematics

contestada

Jeff has 12 laptops. The service charges for each laptop are 26. Find the total expenditure

Respuesta :

hollacemcdonne hollacemcdonne

14-12-2017

His total amount of money spent would be 312 dollars. You would multiply the amount of laptops by the amount of money for each one...and why does Jeff have so many laptops, omg. Like, seriously man lol

Answer Link

ashepardson2020 ashepardson2020

14-12-2017

312 would be the correct aanswer 26 times 12

Answer Link

Otras preguntas

Houses can be either domed or octagonal. True or false

what is the correct first step in finding the area of the base of a cylinder with a volume of 140 pi cubic meters and a height of 12 meters

Larger fonts, bold type and other stylistic devices such as boxes are most commonly used to

Why would an author choose to use satire

PLEASE HELP!!!!! What is the value of x in the matrix equation below?

In a(n) _____, the company stops the disputed behavior but does not admit that it broke the law.

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

PLS HELP:)!!!!!!! Like a great rambling meat grinder, Godzilla clambers his way through cities, pulverizing buildings and leaving shreds of civilization clumped

By the 1830s the Cherokee tribe had developed a/an A. treaty with the government. B. strong leadership. C. written language. D. army.

Write an exponential function y=abx fot a graph that includes (2,24) and (3, 48)