Seudónimo Seudónimo
  • 12-10-2015
  • Geography
contestada

What is the land like in the south and southwest parts of Asia?

Respuesta :

iszymohr iszymohr
  • 12-10-2015
it depend on the area, places such as Indonesia is very tropical and humid and well as India all though much more dry, but places near mount Everest is filled with mountains.
Answer Link
loaring68 loaring68
  • 12-10-2015

very
rough, population is very high and land is dry due to the amount of extreme heat weather.


Answer Link

Otras preguntas

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Please help me with this two step math problem! THANK YOU !!!!!!!!
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
how do you know 8 thousandths is less than 1 hundredths
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Do all your pet's offspring look the same? If no, then explain why they look different.