Seudónimo Seudónimo
  • 01-10-2015
  • Mathematics
contestada

List 3 equivalent ratios of 5/2

Respuesta :

tararaley tararaley
  • 01-10-2015
3 equivalent ratios or 5/2
10 /4
20/8
30/12
Answer Link
Eglor Eglor
  • 01-10-2015
10/4
15/6
20/8

Think about multiplying 5 and 2 with the same number. For 10/4 you multiply each 5/2 both by 2 and etc.. 
Answer Link

Otras preguntas

ow many solutions does the equation 5m − 5m − 12 = 14 − 2 have? Zero One Two Many
what is the most important factor that holds a gene pool of a species together and prevents speciation?
Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates
Joseph and cleoma, who made the first cajun recording, were husband and wife
Joe has always believed that he is lousy at athletics. when he tried to play soccer, he was sure he would not be good at it, and indeed, he was not very adept.
Why did some americans feel that the united states should help europe after world war ii?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the
20% of what number is equal to 2/3 of 90?
Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?