rvpprimerica20oxu0hj rvpprimerica20oxu0hj

15-10-2017
Mathematics

contestada

Mary Sue bought two dolls priced at 7.40 each. The tax was 0.98.She paid the clerk with a 20.00 bill. How much change should she get back

Respuesta :

Kaylao22 Kaylao22

15-10-2017

7.40 x 2 + .98= 15.78 if she pays with $20 than her change will be $4.22
Hope this helps :]

Answer Link

Otras preguntas

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

In what four ways did Hitler break the Versailles Treaty? -built up Germany's military -invaded Poland -invaded Austria -invaded Italy -invaded France -invaded

I need help with three questions 1)5d-4=4-d2)-10e+15=95-30e3) 15t+17=13t+14

scientist were able to determine the age oh the earth from rock samples that were analyzed. what technique what used to do this?

a spinner has 5 sections labeled a b c d and e the spinner was spun 84 times and the results are recorded in the table. what is the experimental probability o

A bag contains 5 blue marbles, 3 red marbles, and 2 yellow marbles. You select a marble at random. What is P(yellow) ?

Which statement is true? Voltage varies throughout a parallel circuit. Voltage remains the same throughout a parallel circuit.

What does neatness in a cover letters formatting , tone , and punctuation reveal to a potential employer

How does Dickinson support her assertion that poetry is more expansive than prose? 1. She looks for examples of the wondrous in the world. 2. She argues that

which of these statements is false concerning the medical term endocardium