stephaniexoxo98 stephaniexoxo98
  • 03-09-2015
  • Mathematics
contestada

Solve (12ds)/w=CD for w

Respuesta :

Sarah4922 Sarah4922
  • 03-09-2015
The answer is (12DS)/cd=w
Answer Link

Otras preguntas

what is the object of the following sentence? My best friend left
In a random survey of 100 students, 30 chose soccer as their favorite sport to participate in. There are 350 students in the school. How many students are likel
What are the main functions of the females and male reproductive systems ?
What does it mean by 不能避免?
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
You are given a solution of sugar and sand in water. Your task is to separate the sugar from the sand. Which of the following experimental designs would you cho
Chelsea divided an apple into 8 equal pieces.she put the other 3 in the fridge. what fraction did Chelsea eat??
What was the purpose of the Tennessee Valley Authority during the Great Depression
An experimental control is a test that lacks the experimental variable. Was one of the solutions prepared in this lab a control? If so, which one? ____ In our e
An isosceles triangle has congruent sides of 20cm. the base is 10 cm. what is the area of the triangle