Morgan011001 Morgan011001

02-09-2015
Mathematics

contestada

The minimum value of 2x 1 is 13.... How is this written in a algebraic expression?

Respuesta :

emma2020215 emma2020215

02-09-2015

2 x 1 >= 13 that is how it is an algebraic expression

Answer Link

Otras preguntas

Which phrase is NOT a way to state the meaning of the expression x – 3? The difference of a number and 3 A number minus 3 A number subtracted from 3 3 less than

The table shows the battery life of four different mobile phones: Mobile Phone Battery Life Phone Battery Life (hours) A 20 B 25 C 10 D 18 If 8.45% of the batte

What factors can affect mental health

Which of the following can not make you more fatigued when driving? A. Depressants B. Stimulants C. Barbiturates D. None of the above

Which type of health insurance plan is not considered a managed care plan?

A guaranteed protection against vague laws is known as which of the following?

If 5 potatoes together have a mass of 1 kg and 8 pears together have a mass of 1,200 grams, which has the greater mass, potato or pear? explain.

The number of degrees of freedom for a test cross of an ss/rr individual would be

Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat