maxoemh maxoemh
  • 01-05-2017
  • Mathematics
contestada

Which is equivalent to ?

243x



Respuesta :

Babybeautystar
Babybeautystar Babybeautystar
  • 01-05-2017
The answer would be x = 81/9841 = 0.008
Answer Link

Otras preguntas

In the cartoon what Us policy is being represented? A) lend lease B) isolationism C) agreement
Please help with multiplying binomials! Show your work! (3n+2)(n+3)
True or false the largest landforms on the earth are called countries
An episode is A. the beginning of a sonata. B. a scene from an opera. C. a key change. D. a section of a rondo.
triangle shown to the right is 120 sq units. find the base and height
a direct result of United States involvement in World War II was?
Which of the following is the most dominant resource used by Iraq? technology fishing industry oil steel industry
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
Muhammad is purchasing an air purifier for $143.95, including tax. He gives the sales clerk 1 fifty-dollar bill, 3 twenty-dollar bills, and 4 ten-dollar bills.
What are the key characteristics of a synthesis reaction