kieshiabrown6
kieshiabrown6 kieshiabrown6
  • 03-04-2017
  • Mathematics
contestada

what 5 divided by 125.

Respuesta :

sethpollard45
sethpollard45 sethpollard45
  • 03-04-2017
the answer is 0.04 its that easy

Answer Link
Аноним Аноним
  • 03-04-2017
0.04, or if you mean 125 divided by 5, the answer would be 25. I hope this helps you! :D
Answer Link

Otras preguntas

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
What integer represent 11 degrees above zero?
Before world war,which of tue following characteristics describes a typical woman who worked outside of home
help me please :'-(((((((
Which of these conclusions is most likely correct about the location from where the fossil was discovered? It was a sea which was replaced by a forest. It was a
what is the solution to the equation 3x + 15 = 9
How is being “cute” for a dog an evolutionary advantage?
Find the area of the figure.
which expression represents the total of steps john will walk if he meets his goal
How does skillful rhetoric increase the effectiveness of persuasive writing? by making logical points by creating emotional impact by entertaining the reader wi