15-03-2017
Mathematics

contestada

A rectangular garden has a perimeter of 28 yards the width of the garden is 6 yards less than its lebght what is the area of the garden in square yards

Respuesta :

ryantheguido ryantheguido

20-03-2017

I think it would be 40. 28-2(6) = 16/4 = 4. 4 * (6+10) = 40.

Answer Link

Otras preguntas

Find the area of the triangle that has a base of 4.2 mm and a height of 1.5 mm.

When discussing the elements of style, what does diction refer to? diction refers to the meaning of the words used. diction refers to spelling of words. diction

A 42.5 g piece of aluminum (which has a molar heat capacity of 24.03 j/ocmol) is heated to 82.4oc and dropped into a calorimeter containing water (specific heat

A two-dimensional section of the body is known as an

what is the distance between the points (4,3) and (-6,3) ???

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

helppppppppppppppppppppppppp

As a company manager for claimstat corporation there is a 0.40 probability that you will be promoted this year. there is a 0.72 probability that you will get a

Which group’s presentation would most likely use a persuasive tone?

Leaves curving towards sunlight are examples of _____.