Help011 Help011
  • 04-03-2017
  • Mathematics
contestada

Find the highest common factor of 8 and 12

Respuesta :

Аноним Аноним
  • 04-03-2017
The answer is 100,if higher 100000
Answer Link
leratolucynthako
leratolucynthako leratolucynthako
  • 04-03-2017
The highest common factor of 8 and 12 is 4
Answer Link

Otras preguntas

The reason why vanessa did not include sports skills activities in her program was that she:
Some puritans wanted to separate from the Church of England
Name a few important body functions that your nervous system controls on its own without you having to think about it much?
Why were senators able to amass more power and influence than congressmen during the gilded age?
help pls :) I am stuck on this chemistry question about percentage yields!
Do cones and polyhedrons both have only one base true or false
why is the inner mitochondrial membrane folded
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
which ones are rational 1. 2.4 2. 74 3. 17.3333333… 4. π 5. 6. –18 7. 8. 87.125 9. –30 10. –8.3 11. 58.25 12. 121 13. 4.5 14.3 7/10
A collection of dimes and quarters is worth 15.25. there are 103 coins in all. how many of each are there