gbell908 gbell908
  • 11-06-2022
  • Mathematics
contestada

Hi can someone help with these questions , thank you!

Hi can someone help with these questions thank you class=

Respuesta :

chayaz21 chayaz21
  • 11-06-2022

Answer: If the number is 5 and up then you round up, for example 6.7 will be rounded to 7, however 6.3 you round it to 6 since 3 is not higher then 5. (Btw this is what I think, but im not 100% sure, but hope this helps!)

34,796

35,000

30,000

144.29

144

Answer Link

Otras preguntas

—-PLEASE HELP QUESTION IS IN THE PIC—
In what ways was World War I a total war?
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
The measure of an angle is 67º. What is the measure of its complementary angle?
How does Elwood feel that no ones knows how he got out of nickel
Is this good enough to submit to my art teacher? 50 points because I have 800
write the sentence as an inequality. A number x is greater than 6 but less than 10. ​
Which sentence uses the word deferred correctly? We deferred the chance to see the movie because we could not wait for opening day. Carlos deferred the bulk of
3. Armadillos and coral snakes both live in Florida. When an armadillo is threatened, it curls up and looks like a ball. A coral snake curls its tail into a tig
Find the total amount owed, to the nearest cent, for a simple interest loan with a principal of $2950, an interest rate of 7.4% and a time period of 1.5 years.