ethanwaddell4265 ethanwaddell4265

01-04-2022
Mathematics

contestada

In creating a new scale for the mercury thermometer, anders celsius initially set the boiling point of water at _____. a. 0° b. 32° c. 100° d. 273°

Respuesta :

mwrobel04 mwrobel04

08-04-2022

Answer: 100 °

Step-by-step explanation:

Answer Link

Otras preguntas

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

-3/5 divided by 11/12. please answer in fraction form

2x³ - 21x² - x = 8x(If you find the answer in Decimal, it's wrong.)

Calculate Gravitational Potential Energy for an object on Earth with a mass of 2 kg and a height of 7 m.

In the year _______, _____% of the world’s population will speak Spanish equaling about 900 million people . ?????

During Peter Zenger’s trial, his lawyer, Andrew Hamilton, asked the prosecution to prove that Zenger had published false material. After the prosecution failed

HELPPPPPPP Which nitrogen base sequence is the partner of C–A–T–C–G–A? a.C–A–T–C–G–A b.G–T–A–G–C–T c.T–G–C–T–A–G d.G–C–A–T–G–T

Rewrite as a square or a cube: 3 3/8

3) A certain medication is prescribed based on the patient's weight at 3mg for every 20 pounds. How many milligrams of medication would you give a patient who w

10,000 more than five hundred four thousand two hundred seventy-two is