antfigueroa1 antfigueroa1

03-03-2022
Mathematics

contestada

how to find slope and writting a equation with tables

Respuesta :

s8853883 s8853883

03-03-2022

Answer:The equation of a line is written as y=mx+b, where the constant m is the slope of the line, and the b is the y-intercept.

Step-by-step explanation:

Answer Link

Otras preguntas

Trick question! An episode is Incorrect answer A. the beginning of a sonata. Incorrect answer B. a scene from an opera. Incorrect answer C. a key change. Corre

activities of which Galileo Galilei and Sir Isaac Newton are most closely associated

The material chosen for your study group a. Should be chosen by the teacher c. Should be material you all already understand b. Should be decided upon before th

According to what you just learned about cause and effect, the “cause” was poor economic policies, and the “effect” was a0 .

Label the states that existed in mid-1850. how many of them allowed slavery? how many did not?

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

All driving skills, including steering, braking, judgment, lane changing and response time are affected when the driver has been drinking.true false

According to darwin's theory of evolution, differences between species may be the result of

Which is true of the federal republic of Germany

Which of the following verbs IS conjugated with être? A.regarder B. parler C. télécharger D. devenir