jamilyataree jamilyataree
  • 02-03-2022
  • Mathematics
contestada

c.) 4. Solve the system of equations
and write the solution in the blank.
y = -3x + 4
y = 4x – 10

Respuesta :

26jxuunzp2
26jxuunzp2 26jxuunzp2
  • 02-03-2022
You can set them equal to each other so -3x+4=4x-10 and then you add 3x and 10 on both sides and get7x=14 and then divided both sides by 7 and get x = 2 and check by plugging in and you get -2 for y on both so solution is x=2
Answer Link

Otras preguntas

How well did feudalism establish order in the Middle ages?
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
How did the mountains in Greece contribute to the rise of city-states?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
what is the geometric mean between 6 and 20?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?