25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

Due to human demand because of its importance to life, the Earth's most precious resource is A. soil.B. saltwater.C. freshwater.D. oil.

QUICK QUESTION! The human body’s main source of energy comes from: carbohydrates proteins fats vitamins/minerals

How does the Tenth Amendment benefit you today? You will have the right to a jury trial if accused of a crime. It allows state governments to provide free educa

The end of the war in Europe compared to the end of the war in the Pacific?

Jonah had 4 books Stacy had 7 books how many books did they not have

The results of improved agricultural practices include all of the following except _____.

Indira Gandhi (Nehru's daughter) witnessed all of the following during her tenure as prime minister EXCEPT a advances in economic productivity. b ethnic unity.

What event constituted the Boston Tea Party

Indira Gandhi (Nehru's daughter) witnessed all of the following during her tenure as prime minister EXCEPT a advances in economic productivity. b ethnic unity.

Where were new immigrants mainly coming from in the late 1800s