27floreso 27floreso

14-12-2021
Mathematics

contestada

What are the answers to Steps 1 and 2 i am on a timed test plz help.

What are the answers to Steps 1 and 2 i am on a timed test plz help class=

Respuesta :

shatter2004 shatter2004

14-12-2021

Step 1
30

Step 2
15/30 and 14/30

Answer Link

Otras preguntas

Why silk is called queen of fiber?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Help with geometry!!!

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

what is the most important factor that holds a gene pool of a species together and prevents speciation?

Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis