gabrielagould80 gabrielagould80

13-12-2021
Mathematics

contestada

3x+1

If your kinda a math nerd you will understand this one

Respuesta :

bbrookiecookie18 bbrookiecookie18

13-12-2021

Answer:

If you equal it to zero (3x+1=0) it will be x= 1/3

Step-by-step explanation:

Subract the 1 over to the 0 then divide the 3 over.

Answer Link

Otras preguntas

What is it called when a minority group is absorbed into the dominant group? a. internal colonialism b. assimilation c. segregation d. population transfer?

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

Melissa’s birthday is next week and she has been receiving cards in the mail with different amounts of money. She has received 5 cards with the following amount

why do plant celss have chloroplasts and animal cells not?

A 10-ounce container of chocolate chips can be used to make 4 desserts. Each dessert has the same number of chocolate chips. Which equation shows how to find

What is the value of x? Enter your answer in the box. x =

Sally and Sue were investigating the topic of friction in science. They used a small car and a ramp as seen in the picture to test what they were learning. They

Powers of the judicial branch: declaring laws constitutional or unconstitutional presiding over presidential impeachment hearings which power should be added to

what is the answer??

Which of these powers is considered an implied power