hellopeople84 hellopeople84

14-10-2021
English

contestada

Needs to be answered ASAP

Needs to be answered ASAP class=

Respuesta :

Summerisswaggy1414 Summerisswaggy1414

14-10-2021

Answer:

1 is speed

2 is displacement

3 is acceleration

4 is distance

5 is velocity

Explanation:

can i pleas get brainless

Answer Link

Otras preguntas

Kelsey is thinking about the problem she has with not knowing how to ride a bike with two wheels. She is writing down ideas to help solve her problem, like prac

Write a short note on the topic ,' My Brother'.

Which polynomial is prime? x2 – 36 x2 + 16 x2 – 7x + 12 x2 – x – 20

le rire est il utile ou unutile

(give the answer of all questions with punctuation marks and give the correct punctuation mark)7. showed, the old man, the way, the kind boy with punctuation m

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Chris can do 30 pushups in 60 seconds. At this rate how many pushups can he do in 360 seconds?

What is the antonym of combine

why is candy bad for you

Find the value of each variable. Assume it is a 45 45 90 triangle. Round to the nearest tenth.