smess12 smess12

15-12-2016
English

contestada

is this a compex sentence: Corinne was definitely, indisputably the right person for the job.

Respuesta :

15-12-2016

Complex sentences have two clauses. Because the sentence has a comma, it's not a complex sentence.

Answer Link

alasalmo14 alasalmo14

26-02-2019

The correct answer is: Simple.

Answer Link

Otras preguntas

Suppose that the Chinese central bank has been intervening in the foreign exchange market, buying U.S. dollars in the market in an effort to keep its own curren

Why did Texas encourage immigration after the Civil War? a. The state wanted a greater variety of peoples living in its boundaries in order to compete with the

For the given circle which of the following is true regarding its circumference and area.

Helen is planning to take a sabbatical to go to Sweden and study how they utilize nature to teach preschoolers. It fascinates her to now that the children spend

What are Three Ways in Which Mercado is important in the daily lives of residents in Latin America

Cybil is about to deliver a baby. Her husband, Bruce, is driving to the hospital at 80 miles per hour. Their son Will says, "Daddy, don’t go that fast, you migh

PLEASE HELP FAST!!! Suppose you want to apply for the job that interested you in the Notebook Handout. Describe two actions you can take today and two actions y

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1

Can the sides of a triangle have lengths 2, 5, and 16? Yes or No

Fairview Clothing purchased land, paying $ 100 comma 000 cash and signing a $ 250 comma 000 note payable. In addition, Fairview paid delinquent property tax o