6dd9e3sad5 6dd9e3sad5

03-06-2021
Arts

contestada

What chord do chord progressions usually end on?

I
IV
V
vi

Respuesta :

03-06-2021

Answer: Between IV and V

Answer Link

allytatto allytatto

24-01-2022

Between V and VI I hope this helps you

Answer Link

Otras preguntas

Could someone help me with this ASAP? Its about the Odyssey.

The equation y = 4.75x + 20 gives the cost y of towing a car if the car is towed x miles. Which statement is true? A.For every mile the car is towed, the cost d

writing process part 1

write the mole ratio of (Mg+2HF➡MgF+H2)

Nancy wrote the following the riddle :I am a number between 25 and 50.my ones digit is three less than my tens digit . I am a prime number.

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

can someone help with my conclusion i don't know what to put !? Should the private lives of famous people be off limits? Because they deserve privacy, they do n

What impels Rabbi Eliahu's son to desert his father on the march to Buchenwald? Question 5 options: his inability to locate his father during the forced marc

which of the following statements about fdic insured accounts is correct

What did Martin Luther post on a church door to publicly criticize the misuse of indulgences? A. Ninety-five theses B. Reformation C. Ten Commandments D. Li