starlightgold21 starlightgold21

04-05-2021
Mathematics

contestada

The central angle of a sector is 100° and the radius of the circle is 17 yds. What is the area of the sector to the nearest tenth?

Respuesta :

rasheemg847923 rasheemg847923

04-05-2021

Answer:

9

Step-by-step explanation:

pork plus allpurpose

Answer Link

Otras preguntas

Been stuck on this question for 20 minutes, can someone please help.

Help please look picture and match

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Write a short poem about the joy of reading.

WHY do you think the USA felt justified and entitled (deserving) to continue expanding westward? Type your answer in the box below:

Evaluate the expression when a = 10, b = 9, and c =4 a+9c

The perimeter of a square is 66.8 cm. What is the side length of the square? A) What is the equation that models this situation? B) Use the equation to find t

Graph the linear equation. Find three points that solve the equation, then plot on the graph. 3x - 4y = -18

Highest common factor of 12 and 18

When compared to Nagasaki, Hiroshima was which of the following? A. larger in size B. smaller in size C. the same size