bluemiastar10 bluemiastar10

04-05-2021
Mathematics

contestada

-6x-5>-4(x-1)+3. Solve step by step pls

Respuesta :

Noahhunter Noahhunter

04-05-2021

Answer:

Step-by-step explanation:

-6x-5>4(x-1)+3

-6x>4(x-1)+8

-6x>4x-4+8

-6x>4x+4

-10x>4

-x>.4

x<-1

Answer Link

Otras preguntas

Which statement describes a main difference between CPR performed on adults and CPR performed on infants? a) For adults only, alternate between compressions a

zimmerman note definition

Nigeria’s economy has relied on its oil industry to create jobs . When world oil prices dropped , their economy collapsed. This is a problem primarily caused by

what is r in this equation? πr^2=42π

What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which great society program was a comprehensive health insurance program for all senior citizens?

During the cross-bridge cycle, after the calcium binds to troponin, what happens next?

6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above

What is the domain of the this function?