arlene31 arlene31

13-04-2021
Mathematics

contestada

Find the slope of the line that contains (5,-6) (-6,-6).

Respuesta :

5926001540 5926001540

13-04-2021

Answer:

There is no slope.

Step-by-step explanation:

Answer Link

Otras preguntas

One vertex of a triangle is located at (0,5) on a coordinate grid. After a rotation, the vertex is located at (5,0). Which rotation could have taken place? A ro

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTA

20 PTS! Is the answer h=2.7?

1. Which items best describe a desert? A. Can lose more water than they receive B. Covers 1/3 of the total land on Earth C. Can be cold or hot climates D. Typic

Lol somebody tell me the awnser pls

What causes the ocean to become more acidic? The ocean becomes more acidic when it absorbs more carbon dioxide. When the fish in the ocean decompose, the wate

How did the kings of France increase their power?

Was reconstruction a success or a failure? Explain? Yes or No

The Founding Fathers were creating a nation like no one other, they were looking to solve the following problems. A.create governments, create rights, create ci

james determined that these two expressions were equivalent expressions using the values of x=4 and x=6 which statements are true? Check all that apply.