08aisbry07006 08aisbry07006
  • 02-03-2021
  • Chemistry
contestada

Trees that have thick , waxy needles to prevent water loss and perfect from cold would most likely be found in what biomes ?

Respuesta :

babysumeya7
babysumeya7 babysumeya7
  • 02-03-2021
Answer: Taiga

Step-by-step- explained
Answer Link

Otras preguntas

I need help on this homework I need it for finals
Matt and Trey are remodeling their gardens. Matt purchased 8 ferns and 1 rosebush for $35. Trey purchased 4 ferns and 3 rosebushes for $25. Determine the price
Building block of protein
You have an ecosystem with the following organisms: birds, fruit trees, tigers, and monkeys. Which list would best describe the food chain?A. Tigers, monkeys, b
Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5
A nurse is collecting a urine specimen prior to measuring the albumin level in a client’s urine. A colleague states, "I thought albumin was related to liver fun
Which civilization created the art shown here? Egypt Mesopotamia Indus Valley China
6. What did Plato say was the way to a good life?
Frederick Jackson Turner's frontier thesis defined the American character in what way? A. The American character remained, for the most part, European in manner
Refer to the following selected financial information from Marston Company. Compute the company's accounts receivable turnover for Year 2. Year 2 Year 1 Accou