Seudónimo Seudónimo
  • 02-03-2021
  • Business
contestada

What does the phrase “last in, first out” mean?

Respuesta :

aaliyah672710
aaliyah672710 aaliyah672710
  • 02-03-2021
It’s used to account for inventory. It record the most recent produced items as sold first. It records how the newest item made is the first to be sold. Last in first out is used during inflation as a way to reduce income tax.

Hoped that help sorry if it didn’t
Answer Link

Otras preguntas

Please help with question
When citizens cast votes for President in November, they are participating in a
8) Scientists typically transgenically alter ________ to produce more desirable species.
Marco is from el salvador but lives in the united states and rarely sees his family. he has become very close to his roommate's family. they include him in all
cannot be written as a terminating or repeating decimals consist of decimals that are both non-terminating and non-repeating cannot be written as a fraction
Who first discover the USA
How many whole numbers are there with not more than 4 digits? I thought the answer is 9999, but it apparently isn't....
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Please help algebra question
Vera’s lunch cost $9.00. She left a tip worth 15 percent of the cost of her lunch. What is the total amount, including the tip, Vera paid for her lunch