cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

why would an athlete need to be concerned about a twitch or sustained contraction

Please tell me some topics I can do for my persuasive research essay. It have to had something to do with science and technology, the environment, national poli

How do I solve a hanger diagram?

hello guys. How is everyone? i'll give someone brainlyist!

What kind of cell has a nonspontaneous voltage? An electrolytic cell A dry cell A wet cell A voltaic cell

I need help please with this equation

Given h(x) = 32 3x – 3, find h(3).

Plz help me w this I’m so confused :/

Fill in the blank: Quand blank en France? A voyagez-vous B vous C voyagez D voyager

Where would you expect detergent and shampoos to be found?