Notknown1rgege23123 Notknown1rgege23123

03-12-2020
Mathematics

contestada

Find the value of x and y that satisfy both equalities x/5=y/3 and 12/y=4/5 HURRY!!!!

Respuesta :

keliciagreen11 keliciagreen11

03-12-2020

x=25,y=15 Not to sure abt this answer but I think I got it

Answer Link

Otras preguntas

Question 1 Simpson has a rectangular fish aquarium that measures 31 inches long, 13 inches wide and is 28 inches deep. What is the maximum amount of water

Corporate bonds from Hyren Airlines are selling at 106.133, bonds from Xyx Motors are selling at 97.701, and bonds from Ergar Appliances are selling at 101.294.

Which factor contributed to Abraham Lincoln issuing the Emancipation Proclamation? A. He was a strong abolitionist. B. He needed the freed slaves to fight as so

I'm having so much trouble with this one problem can you please help me so that I don't get in trouble for not having it done.

A ring cost $27 more than a pair of earrings the ring cost $90 write an equation that can be used to find the cost C in dollars of the earrings

Based on what you have read, why does St. Augustine appear to see no conflict between faith and reason?

The Second Amendment reads as follows:A well regulated Militia, being necessary to the security of a free State, the right of the people to keep and bear Arms,

The first means of achieving coherence which the speaker mentions is the _________ bridge.

Which diagram correctly arranges systems of government in order from least powerful to most powerful?

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’