Seudónimo Seudónimo
  • 12-11-2020
  • Spanish
contestada

How is Puerto Rico’s religious demographic different from that of other Spanish-speaking countries?

Respuesta :

axjasminscc axjasminscc
  • 12-11-2020

Answer:

Puerto rico's religious demographic is different from other spanish-speaking countries because they have different religions. Mexicans and other spanish speakers are most likely to be Catholic while Puerto Rican's are more likely to be evangelical.

Explanation:

Answer Link

Otras preguntas

The Panama Canal connects what two bodies of water?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How did the mountains in Greece contribute to the rise of city-states?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
how do you know 8 thousandths is less than 1 hundredths
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
A vehicle is only 15% efficient. What happened to the other 85%?