3076850 3076850

12-11-2020
Chemistry

contestada

Boron- 11
Atomic #
Atomic mass
# of protons
# of neutrons
# of electrons

Respuesta :

Dyinql0ser Dyinql0ser

22-11-2020

Answer: 5 protons 6 neutrons and 5 electrons. and atomic number is 5.

Hope this helps!

Answer Link

Otras preguntas

a baker made 81 onion bagels one morning. the onion bagels were 45% of the bagels she made. how many bagel do the baker make.

Carolyn is making a quilt using blocks like the one shown below. All the shaded squares are the same size and all th shaded triangles are the same size. What is

How was religion an important factor in the colonization of the americas

From 1942-1945 America was in alliance with who

What is a difference in a wrinkle in time book and moive

according to Graham Allison in his book nuclear terrorism what percentage of the 50,000 daily cargo containers to the United States were screened

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

Which of the following inequalities matches the graph? A) x <(or equal to) -1 B) x >(or equal to) -1 C) y <(or equal to) -1 D) y >(or equal to) -1

the national defense act was passed in response to what event

Last year there were 43 science projects submitted by students at a science fair. This year there are 52 science projects. To the nearest tenth, what is the per