ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

What was a consul? Help me

14 divided 4 and 7/8 written in simplest form

This boy said he was finna destroy me and winked what does that mean

The price of an item has been reduced by 45%. The original price was $60. What is the price of the item now?

In Passage 1, to what does the word nature, as inscribed on the silver casket, refer? “The tale of the three caskets” Human nature Natural beauty Mother Natu

Mixing baking soda and vinegar is an example of an endothermic reaction. This means... A. baking soda and vinegar are products in this reaction. B. energy is t

about how long ago did modern humans migrate to australia

60.98 x 62xv Whats v

Por favor ayuda! MARCARÁ EL MÁS CEREBRAL Muchos niños no fueron a la escuela porque sus padres necesitaban su ayuda en casa. Si los niños iban a la escuela, era

HURRY Which Enlightenment principle did Napolean adhere to? A government that does not work for its people can be overthrown. Unrestricted civil liberties are n