autumnperezgame autumnperezgame

01-06-2020
Mathematics

contestada

Can anyone create an exponential growth function from a growth rate of 35%????
Thank you

Respuesta :

Аноним Аноним

01-06-2020

Answer:

there is this video

Step-by-step explanation:

just look up this

How do you find the growth rate of an exponential function? hope this helps you will find your answer i hope

Answer Link

Otras preguntas

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

what was the result of FDR's New Deal

What is a couplet? a four-line stanza two lines of verse that restate the theme an unstressed syllable followed by a stressed syllable

" according to the preemption doctrine, when state and federal laws are in conflict, which laws trump the other? "

Why did colonists come to Jamestown originally? A. To search for gold B. To farm tobacco C. To promote religious tolerance D. To escape relig

Which approach in theatrical realism continues to be commonplace in acting today? A. Using everyday speech to allow the audience to reflect on their own ide

Psychologists define stress as

solve the formula A=10+ry. solve for y

The period if a function is 4pi How many cycles of the function occur in a horizontal length of 12pi? (answer was 3) QUESTION: Which type of transformation of

Miss brooks made 27 cookies for a bake sale she puts three cookies in each bag if 4 bags were sold how many bags are left