isabella8816
isabella8816 isabella8816
  • 02-05-2020
  • Social Studies
contestada

Define “political symbolism”

Respuesta :

mahdy43
mahdy43 mahdy43
  • 02-05-2020
Political symbolism is symbolism that is used to represent a political standpoint. The symbolism can occur in various media including banners, acronyms, pictures, flags, mottos, and countless more.
Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
If you can answer all requirements I’ll give brainliest
Someone please help me with this , open the picture
The rule is x→y=−x. Copy and fill in the table with at least 4 points. x l y l l
find the equation of the exponential function represented by the table belowx y0 31 92 273 81
Chasing Lincoln's Killer is classified as biography autobiography informational text fiction literary nonfiction
An interest rate of norminal 12% per year , compounded weekly is
A jar contains 3 blue marbles, 4 yellow marbles, and 3 green marbles. What is the probability of randomly choosing a yellow marble, replacing it, and then choos
which two adaptations of herbivorous enables them to digest cellulose​
a square with sides equal to 6 has the same area as a triangle with a base of 9. What is the height of the triangle?