eligp994
eligp994 eligp994
  • 12-04-2020
  • Mathematics
contestada

Can someone help me on this question? Please

Can someone help me on this question Please class=

Respuesta :

gmany
gmany gmany
  • 12-04-2020

Step-by-step explanation:

Linear function: y = mx + b

Quadratic function: y = ax² + bx + c

Exponential function: y = a(b)ˣ + c

Polynomial: y = aₙxⁿ + aₙ₋₁xⁿ⁻¹ + ... + a₁x¹ + a₀

f(x) = 2x + 3 - linear function and polynomial

f(x) = x² + 2x - 3 - quadratic function and polynomial

f(x) = 3ˣ - 2 - exponential function

Answer Link

Otras preguntas

I need an inequality
The measure of an angle is twenty-nine times the measure of a complementary angle. what is the measure of each angle?
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Letters written in the new testament to instruct, encourage, and solve problems are called
Can someone help me with this please for brainliest? your answer choices: Ayer Rock Great Victoria Desert Canberra Coral Sea Sydney Indian Ocean Tasmania Great
A religious leader in a small city led a crusade against local x-rated movie theaters, topless dance bars, and strip clubs, often leading groups of angry citize
I need to find the X's.
help with 26 please:):)
PLS HELP ME ASAP ON 3 THANK YOU SO MUCH!! (Random answers gets moderated.)
Why do children worry about their academic achievement? an expectancy-value perspective on elementary students' worries about their mathematics and reading perf