robjc23 robjc23
  • 17-01-2020
  • Mathematics
contestada

(X^3y^2)^3z^4 simplify

Respuesta :

girlsdayout666
girlsdayout666 girlsdayout666
  • 18-01-2020

Answer:

x^9^y^2 z^4

Step-by-step explanation:

Answer Link

Otras preguntas

You randomly select one card from a​ 52-card deck. find the probability of selecting a black seven or a red three.
Which of the following are sentence fragments? I. Sarah who works at the CD store. II. She smiled. III. At noon tomorrow.
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
True or false looking at the teeth of a horse can help determine the animal's age
In a complete flower, a(n) _____is found on a filament and a(n) _______ is found on a(n) _______. anther; stigma; style style; anther; stigma stigma; style; ant
Help as soon as possible
Which of the following types of information is suited for display on a double line graph? a. annual changes in Melody's height and weight from 5 to 10 years old
The separation of populations by a barrier such as an ocean is called
how do conservationists make use of watersheds and ecozones?
There are 10 boxes in a grab bag boxes are identical except for its at 7 of them contain $20 bills a contest winner gets too pick two boxes from the grab bag wh