gyprice gyprice
  • 03-10-2019
  • Mathematics
contestada

How to order 75/100, 1/4, 1/10, 1/9, 8/50 from greatest to least

Respuesta :

albaniansoccer5
albaniansoccer5 albaniansoccer5
  • 03-10-2019

Answer:

75/100, 1/4, 8/50, 1/9, 1/10

Step-by-step explanation:

The way you wanna do it is by simplifying them all to make it easier.

Get all their denominators to 100 or as close to 100 as you can.

that makes 75/100, 10/100, 16/100, 25/100, 11/100

Hope this helped ! !

<3

if it did please consider marking brainliest i would appreciate it greatly :)

Answer Link

Otras preguntas

What two words complete the quotation? "Birling and Mrs Birling exchange bewildered and __________ __________ glances."
i want a writing about sport 2 to 3 paragraphs need it please ​
eassy on how to plant a yam​
José is climbing a mountain. Using a rope, José climbs down from the top of a steep cliff for 4 minutes at a rate of 12.2 feet per minute. He then climbs back u
[tex]x\sqrt{2} +3=-2[/tex]
Write an equation in slope intercept form that represents the graph.
does german eat turkey on Thanksgiving​
How do I find the vertex of a table when the y values are the same for 2 different x values? The x values are: -9, -7, -5, -3 and the y values are 0, 8, 8, 0
Hi can someone please help me with this. I’m struggling on what to put in the blanks.
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG