josiahyou94
josiahyou94 josiahyou94
  • 04-06-2019
  • Mathematics
contestada

If point (x, y) is reflected over the y-axis, the resulting point is (-x, y)

Respuesta :

trevordoyleione
trevordoyleione trevordoyleione
  • 04-06-2019

Answer:

That is correct

Step-by-step explanation:

If its reflecting over the y axis only the x is becoming opposite.  the x becomes -x, so (x, y) is reflected over the y-axis, the resulting point is (-x, y)

Answer Link

Otras preguntas

A section in a history book describing the conditions and causes of the Great Depression in the Midwest in the 1930s. a.
Larned Corporation recorded the following transactions for the just completed month. $78,000 in raw materials were purchased on account. $76,000 in raw material
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
What does the word dynasty have to do with Imperial China?
Consider the following equation. 4x + 2 = 8x - 5 Which equation and explanation could represent a step in finding the value of x​
which of these jobs is a top growing career in health sciences
help plss Simplify. 14(1−23)2+13 Enter your answer, as a simplified fraction, in the box.
find the square root of √25.65 and correct upto 2 decimal places​
what does the symbol ∈ mean
2 2/5 x 5/7 in simplest form