Ahniahdupree13 Ahniahdupree13
  • 16-03-2019
  • History
contestada

why did muslims not want ti be oart of an independent india

Respuesta :

Sjejrjrjdjejeji
Sjejrjrjdjejeji Sjejrjrjdjejeji
  • 16-03-2019
Muslims did not want to be part of an independant india for many reasons:
1. Their religions and cultures differd a lot, as indian culture was interferring theirs
2. They wanted their own independance,
Answer Link

Otras preguntas

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
31+34=90-n 45+1=70-k 6×9=41+m
Please help solve, thanks in advance!
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
What statement best describes a republic?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
What was religion like in Shang China?