Seudónimo Seudónimo
  • 11-02-2019
  • Mathematics
contestada

What is the commutative property and how do I use it?

Respuesta :

Аноним Аноним
  • 11-02-2019

Commutative Property is a type of swapping property, you switch the numbers and get the same answer. This only works on addition and multiplication (+,x) Here are some example to show you:

3*6=18 = 6*3=18 and 3+6=9 = 6+3=9

Answer Link

Otras preguntas

Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?
Give two reasons that older adults face a greater risk of vitamin d deficiency than younger people?
Illinois senator who believed slavery question should be settled by popular sovereignty
help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute
True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.
This rectangular prism is created with centimeter cubes. how many cubed centimeters make up this prism? rectangular prism composed of unit cubes. cm3
Help plsssssssssssss
How does the receptor make the organism successful in reacting to their environment?
Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat