bigand bigand
  • 12-04-2016
  • Advanced Placement (AP)
contestada

Flash flooding is most likely to occur when heavy rain falls on

Respuesta :

kkanns kkanns
  • 12-04-2016
flat land because it has no slope for the water to travel down or no drains for it to drain in
Answer Link
Аноним Аноним
  • 12-04-2016
Super dry flatlands it will flood on any flat land but it's more likely to do it on super dry like Arizona or New Mexico because they've been dry so long they don't have time to soak up all the water fast enough in turn it floods.
Answer Link

Otras preguntas

a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
i need help with #3
2ln(5x)=8 solve for x
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
Help pl0x, Algebra 1
What are the factors of 6x + 24?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.