lizziev1655
lizziev1655 lizziev1655
  • 14-01-2019
  • Mathematics
contestada

hi can you please help me

hi can you please help me class=

Respuesta :

ThisKidNeedsHelp ThisKidNeedsHelp
  • 14-01-2019
6/9 = 2/3
2/5 =4/10
90/100 = 9/10
5/4 = 10/8
Answer Link
faithvenable73
faithvenable73 faithvenable73
  • 14-01-2019
Equivalent fractions for 6/9:

1. 1 3/9
2. 2/3


Equivalent fractions for 2/5:

1. 2 1/5
3. 4/10


Equivalent fractions for 90/100

1. 18/20
2. 27/30

Equivalent fractions for 5/4:


1. 10/8
2. 15/12




Hope this helps!
Answer Link

Otras preguntas

Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Susan ........ (Run) to school because she was late.
how do you say theatre in Spanish
What is the sum of 6/10 plus 7/12
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5