eliannah
eliannah eliannah
  • 14-11-2018
  • History
contestada

How many of the nations 24 largest cities and towns were located in the south

Respuesta :

wane67 wane67
  • 14-11-2018
only 6 of the nation's 24 largest cities and towns we're located in the south
Answer Link

Otras preguntas

Find the sum (the total measure) of the interior angles of a 17 sided polygon??
Gatsby returns to lousville after daisy breaks up with him. why is this significanat?
Drag the tiles to the correct boxes to complete the pairs. Match the stages of the water cycle with the correct places in the model.
I sighed with impatience. In recent months Armand had become a figure of authority, siding with my father and mother occasionally. As the oldest son, he sometim
The last line of each stanza from the poem "I Know Christ" begins with the same words. What are they?
Who was the 30th president of the us?
The following list contains some common polyatomic ions. Using the charge on these ions and the idea of valence, predict the formulas for the following: nitrat
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
zheng he sailed the western sea seven times what area is included in the western sea
One emerging type of trojan horse is called a ____-access trojan.