shaemartinpdz1ov shaemartinpdz1ov

12-09-2018
Mathematics

contestada

will someone help me with this please

will someone help me with this please class=

Respuesta :

bubster5820 bubster5820

12-09-2018

the first answer choice, associative property of addition

hope this helps. gl!

Answer Link

alexsun2006oy6erw alexsun2006oy6erw

12-09-2018

associative property of addition

Answer Link

Otras preguntas

help plz asap !!!!!!!!!!

How would you describe neville chamberlain's policy toward hitler in the late 1930?

Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)

Why is the epa considered to be one of the most powerful bureaucracies?

I=$310 P=$1,000 t=5 years

Why was the sinking of the Lusitania important? A. It highlighted British aggression towards neutral shipping. B. It kept the United States out of

These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and

Which of the following is a run-on sentence?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

you rent a well-lit flat in philidelpia for $1,080 per month. your landlord, knowing that new apatments are being built nearby, decreases you rent by 3%each yea