noracopeland55
noracopeland55 noracopeland55
  • 15-01-2024
  • Mathematics
contestada

Calculate the surface area. (a) Find the sum of the area of the faces of the prism. (b) Use the formula. SA = 2B + ph 3 cm 2 cm 3.6 cm 3 cm​

Respuesta :

Otras preguntas

Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
The section of the small intestine between the duodenum and ilium?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
What kind of problems did increased urbanization cause? During time of industrial revolution
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
Step by step directions Square root for 480