aidenlumpkins219 aidenlumpkins219

13-11-2022
Biology

contestada

Using the following genomic sequence:

1) Underline each Intron

2) Circle each exon

GUUAUGAGUCGUUGGCAUUAAUCUUUCCUUAUGAUUGUCGCUGAUCGUUAG

UCGUCCAUGCGUGGUGGCUGACUUCCAAUGACCAAAUCUUCGGUGGCGGAG

UAACAUAUAAGAAUGACCAAAAGGCGUCGAUGAGGAUGUGGCAAUUAACAUC

Respuesta :

Otras preguntas

Simplify the ratio 18b^2 to 45b

Write 30,000,000,000 + 300,000 + 20,000 + 4 in standard form

what ending should this word have? predict- able ible

What is the tone of the following lines in "at the tourist center in Boston"? I seem to remember people, at least in cities, also slush, machines and garbage. P

4/? Is equivelantnto ?/9

most of the keyboards provided with desktops are?

A water balloon was dropped from a high window and struck its target 1.1 seconds later. If the balloon left the persons hand at -5.0 m/s, what was the velocity

How does place value help me subtract decimals?

what is the equation, in slope-intercept form, of the line that is perpendicular to the line y – 4 = –(x – 6) and passes through the point (−2, −2)?

How to write 281,480,100 word form